View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8246_low_31 (Length: 245)
Name: NF8246_low_31
Description: NF8246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8246_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 2 - 205
Target Start/End: Complemental strand, 43409518 - 43409315
Alignment:
| Q |
2 |
tttaggtctattattggctataaagtggccaatagagttgggtttaaaacatgtaaaatttgaacatgatcaaacgattgatgataagtatcatagaatt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
43409518 |
tttaggtctattattggctataaagtggccaatagagttaggtttaaaacatgtaaaatttgaatatgataaaacggttgatgataagtatcatagaatt |
43409419 |
T |
 |
| Q |
102 |
caggaaaaccactccgaatgcggcaacaattatggtgtatgaaatgtatcccgctcgatgatgattagtttacagtcacataagtcatgaatgaatagaa |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43409418 |
caggaaaaccactccgaatgcggcaacaattatggtgtatgaaatgtattccgctcgatgatgattaatttacagtcacataagtcatgaatgaatagaa |
43409319 |
T |
 |
| Q |
202 |
tatg |
205 |
Q |
| |
|
|||| |
|
|
| T |
43409318 |
tatg |
43409315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University