View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8246_low_37 (Length: 226)
Name: NF8246_low_37
Description: NF8246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8246_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 19 - 212
Target Start/End: Complemental strand, 43129991 - 43129798
Alignment:
| Q |
19 |
aaagcacctgctgtggattttattgtgtgtatatctaccaccttcttgaaatactcgtgagctgaatcaccggcggcgctgttaggaaacgccgttactt |
118 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43129991 |
aaagcgcctgctgtggattttattgtgtgtatatctaccaccttcttgaaatactcgtgagctgaatcaccggcggcgctgttaggaaacgccgttactt |
43129892 |
T |
 |
| Q |
119 |
tcgtgtttcgaaaccacgaaattgctgttacgaaaacgattccgtatatcattgctcctttcacgttttttactaaacaatacgcgagtataat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43129891 |
tcgtgtttcgaaaccacgaaattgctgttacgaaaacgattccgtatatcattgctcctttcacgttttttactaaacaatacgcgattataat |
43129798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University