View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8247_high_10 (Length: 241)
Name: NF8247_high_10
Description: NF8247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8247_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 82 - 218
Target Start/End: Complemental strand, 16371535 - 16371399
Alignment:
| Q |
82 |
tatagggcattatacttttcatattgaagtgaatttggcattgtcgcccaaaactaaaattaaatggacttttagacctttaa-tttagtttttaccttc |
180 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
16371535 |
tatagggcattatacttctcatattgaagtgaatttggcattgtcgcccaaaacaaaaattaaatggac-tttagacctttaattttagtttttaccttc |
16371437 |
T |
|
| Q |
181 |
aagccggcttcgagtttatagtaaaattttgtctaatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16371436 |
aagccggcttcgagtttatagtaaaattttgtctaatt |
16371399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 8 - 85
Target Start/End: Complemental strand, 16371640 - 16371564
Alignment:
| Q |
8 |
cgagtgagatgaaaaggaagttataaaatgtctatcaaatatcctttatttgctattattttttaattattgtttata |
85 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
16371640 |
cgagtgatatgaaaaggaagttataaaatgtctatcaaatatcc-ttatttgctattattttttaattattgtttata |
16371564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University