View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8247_low_7 (Length: 271)
Name: NF8247_low_7
Description: NF8247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8247_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 10 - 252
Target Start/End: Complemental strand, 47405092 - 47404850
Alignment:
| Q |
10 |
taacacgtattactacacttgtttctcttaattatatgcttcttgttatatgttcattaaggaacaatcgtgctcaattttcttgtctaaagataagtag |
109 |
Q |
| |
|
|||||| |||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47405092 |
taacacctattaccacacttgtttatcttaattatatgcttcttgttatatgttcattaaggaacaatcgtgctcaattttcttgtctaaagataagtag |
47404993 |
T |
|
| Q |
110 |
atttcttatagctttgagttttcaagaaccaccaaatcttttgctatggtcgaccaaactcaaacgtatgagatttagatttaagttctcaagaacctcc |
209 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47404992 |
atttcttatagcttcgagttttcaagaaccaccaaatcttttgctatggtcgaccaaactcaaacgtatgagatttagatttaagttctcaagaacctcc |
47404893 |
T |
|
| Q |
210 |
aaatcttttgctataatcgaccaacctcaaatgcatgaacttt |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47404892 |
aaatcttttgctataatcgaccaacctcaaatgcatgaacttt |
47404850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 126 - 197
Target Start/End: Complemental strand, 47404909 - 47404838
Alignment:
| Q |
126 |
agttttcaagaaccaccaaatcttttgctatggtcgaccaaactcaaacgtatgagatttagatttaagttc |
197 |
Q |
| |
|
|||| ||||||||| |||||||||||||||| |||||||| |||||| | |||| ||||| ||||||||| |
|
|
| T |
47404909 |
agttctcaagaacctccaaatcttttgctataatcgaccaacctcaaatgcatgaactttagctttaagttc |
47404838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University