View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8248_high_11 (Length: 335)
Name: NF8248_high_11
Description: NF8248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8248_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 1 - 306
Target Start/End: Original strand, 3154023 - 3154328
Alignment:
| Q |
1 |
gatgcatgctaatgttctccaccaccatcttggttttctggtcatcggaggaaacttaaagccagcagatgagccttccttcattgctcgaggggcccta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3154023 |
gatgcatgctaatgttctccaccaccatcttggttttctggtcatcggaggaaacttaaagccagcagatgagccttccttcattgctcgaggggcccta |
3154122 |
T |
 |
| Q |
101 |
caagacttgcgcagcgaaggtaacacagggatagtacaagatagaagattttgacccccacttaaaagtaggcttgatgcagaagacatgtctgtgtatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3154123 |
caagacttgcgcagcgaaggtaacacagggatagtacgagatagaagattttgacccccacttaaaagtaggcttgatgcagaagacatgtctgtgtaag |
3154222 |
T |
 |
| Q |
201 |
ccattcctatcacagaaagattgttataaattaagaagccgaaacaaatttttcaaggatggttattgccaaatataagcaccgcagtcaacaattccta |
300 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3154223 |
ccattcctatcacagaaagattgatataaattaagaagccgaaacaaatttttcaaggatggttattgccaaatataagcaccgcagtcaacaattccta |
3154322 |
T |
 |
| Q |
301 |
cagtca |
306 |
Q |
| |
|
|||||| |
|
|
| T |
3154323 |
cagtca |
3154328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University