View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8248_high_14 (Length: 323)
Name: NF8248_high_14
Description: NF8248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8248_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 1 - 313
Target Start/End: Complemental strand, 7665677 - 7665365
Alignment:
| Q |
1 |
aatcattatgtctttagttctttggtttccatgggttgtttttgcccctttcttgccaaccaaccccgcatcatgtttagcatgggggtatctgtgtatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7665677 |
aatcattatgtctttagttctttggtttccatgggttgtttttgcccctttcttgccaaccaaccccgcatcatgtttagcatgggggtatctgtgtatg |
7665578 |
T |
|
| Q |
101 |
taaattaagttagaaatcattatgtcctatgtttgtacctttgactatagatatgcatctgtatatttggctgtttgtgggttaacccagccctcatact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7665577 |
taaattaagttagaaatcattatgtcctatgtttgtacctttgactatagatatgcatctgtatatttggctgtttgtgggttaacccggccctcatact |
7665478 |
T |
|
| Q |
201 |
ccaagctcatgttaagctttttaggtggtaagtttaaaaaatgattttgcatttagaggagatttaaactgccgtagtatgaatgttcaattgccgtagt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7665477 |
ccaagctcatgttaagctttttaggtggtaagtttaaaaaatgattttgcatttagaggagatttaaactgccgcagtatgaatgttcaattgccgtagt |
7665378 |
T |
|
| Q |
301 |
gtaaacacaggtt |
313 |
Q |
| |
|
||||||||||||| |
|
|
| T |
7665377 |
gtaaacacaggtt |
7665365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University