View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8248_low_21 (Length: 308)
Name: NF8248_low_21
Description: NF8248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8248_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 1 - 305
Target Start/End: Complemental strand, 3153924 - 3153620
Alignment:
| Q |
1 |
ttttatgtcaattggcagtctacctagatggtctctcatagcatacttcttgattgcgtatattaccattgtgaggagaaaagaatggcctcatttcttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3153924 |
ttttatgtcaattggcagtctacctagatggtctctcatagcatacttcttgattgcgtatattaccattgtgaggagaaaagaatggcctcatttcttc |
3153825 |
T |
 |
| Q |
101 |
agatttcacgttgccgtcggaatgttaatcgagatagccttgcaagttaccgggcttgtgagccgttggatgccaccggcgttctattggggtaaagttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |
|
|
| T |
3153824 |
agatttcacgttgccgtcggaatgttaatcgagatagccttgcaagttaccgggcttgtgagccgttggatgccaccggcattctattggggtagtcttg |
3153725 |
T |
 |
| Q |
201 |
gaatgcatttctggaccactgcatttttcctttatctctttacttccatagagtgcgttaggtgtgcccttactggtatgtatgcggatatcccttttgt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3153724 |
gaatgcatttctggaccactgcatttttcctttatctctttacttccatagagtgcgttaggtgtgcccttactggtatgtatgcggatatcccttttgt |
3153625 |
T |
 |
| Q |
301 |
ctgtg |
305 |
Q |
| |
|
||||| |
|
|
| T |
3153624 |
ctgtg |
3153620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University