View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8248_low_22 (Length: 298)
Name: NF8248_low_22
Description: NF8248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8248_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 1 - 271
Target Start/End: Original strand, 2064501 - 2064771
Alignment:
| Q |
1 |
aatcgccaccggtagtaacggcgtcgggattgggaagattgtttccacggcggcttatatttccgatatcaactcggaaactgtctgaagaagttgatcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2064501 |
aatcgccaccggtagtaacggcgtcgggattgggaagattgtttccacggcggcttatatttccgatatcaactcggaaactgtctgaagaagttgatcg |
2064600 |
T |
|
| Q |
101 |
gagaattttcgcgagatcagaatcggaagggagaatgctggagcgacataacggacatgaaagatttgaacggagccatgtgtcaatgcattcagcatgg |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2064601 |
gagaatttttgcgagatcagaatcggaagggagaatgctggcgcgacataacggacatgaaagatttgaacggagccatgtgtcaatgcattcagcatgg |
2064700 |
T |
|
| Q |
201 |
aaagcgtggcaacagagaggaagagaacggaggaggtcggagttacggaactttgataaacagacagcgca |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2064701 |
aaagcgtggcaacagagaggaagagaacggaggaggtcggagttacggaactttgataaacagacagcgca |
2064771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University