View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8248_low_23 (Length: 290)
Name: NF8248_low_23
Description: NF8248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8248_low_23 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 19 - 290
Target Start/End: Original strand, 12550838 - 12551109
Alignment:
| Q |
19 |
gagaaattgtgtaccttgcattgttgtgagaaggattatttatacaatcctagaaaggagctgttgatgcgtaaagggaggaacgttacatatgacaccc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12550838 |
gagaaattgtgtaccttgcattgttgtgagaaagagtatttatacaatcctagaaaggagctgttgatgcgtaaagggaggaacgttacatatgacaccc |
12550937 |
T |
|
| Q |
119 |
ttcattaatggtgtgctcttgcagccgttcaaggtcattgaactcgttgaggcgttacaaatttcaagaatcttatgccaggtggattggtctttgggtc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12550938 |
ttcattaatggtgtgctcttgcagccgttcgagggcattgaactcgttgaggcgttacaaatttcaagaatcttatgccaggtggattggtctttgggtc |
12551037 |
T |
|
| Q |
219 |
aagtgtgctttaaaagagggttgtgacttgtgagttcgcaagagattggaccttagactagtctaaaaccat |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12551038 |
aagtgtgctttaaaagagggttgtgacttgtgagttcgcaagagattggaccttagactagtctaaaaccat |
12551109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University