View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8248_low_25 (Length: 279)
Name: NF8248_low_25
Description: NF8248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8248_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 3273498 - 3273250
Alignment:
| Q |
1 |
cctagattcatatattctaaacataaattttggcatctaatcaaaatcattaataagtctaattacagattcaaaccaatagtcaaatacactctaacac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |||||||||||||||||| ||||||||||| |
|
|
| T |
3273498 |
cctagattcatatattctaaacataaattttggcatctaatcaaaaccattaataagtctaattacataatcaaaccaatagtcaaatgcactctaacac |
3273399 |
T |
 |
| Q |
101 |
tacctcttttttatgctggaaa-actttgaataataccaagttgaacttcttagagttcatgaagagttccctcttaacgt-tttattcgacttcaataa |
198 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
3273398 |
tacctcttttttatgttggaaattttttgaataataccaagttgaacttcttagagttcatgaagagtttcctcttaacgtgtttattcgacttcaataa |
3273299 |
T |
 |
| Q |
199 |
aacttggtcgaatcttctcttcctttgatattatcaaaaatgagacaag |
247 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3273298 |
aacttggttgaatcttctccccctttgatattatcaaaaatgagacaag |
3273250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University