View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8248_low_27 (Length: 275)
Name: NF8248_low_27
Description: NF8248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8248_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 258
Target Start/End: Original strand, 7665667 - 7665924
Alignment:
| Q |
1 |
acataatgattacagtttattgtgttcatccgcagctaatgccttcacaatagttattgggcaggcataatatatgcttgttcacagatcattggactcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
7665667 |
acataatgattacagtttattgtgttcatccgcagctaatgccttcacaatagttattgggcaggcataatatatgtttgttcacagttcattggactcg |
7665766 |
T |
 |
| Q |
101 |
atacactcatccacaagctggcgcaggtttggattctctaaggcagcagcgattctctctttatcgtttaattgcttattcactgcaagaaaatattatt |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
7665767 |
agacactcatccacaagctggcgcaggtttggattctctaaggcagcagcgattctctctttatcgtttaattgcttattcactgcaagaaaatattgtt |
7665866 |
T |
 |
| Q |
201 |
agaagttcatgttgcaggaagtaacgattatataaagtagaagaaagggattgggaaa |
258 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7665867 |
acaagttcatgttgcaggaagtaacgattatataaagtagaagaaagggattgggaaa |
7665924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University