View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8248_low_44 (Length: 202)

Name: NF8248_low_44
Description: NF8248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8248_low_44
NF8248_low_44
[»] chr7 (1 HSPs)
chr7 (20-186)||(34839924-34840090)


Alignment Details
Target: chr7 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 20 - 186
Target Start/End: Original strand, 34839924 - 34840090
Alignment:
20 tgttcgtaaagaagctgagaattgcgattgtcttcaaggtacaatctatttcttgtgcgatttagtacacttgtggaaatcttgattctgttatggcggt 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
34839924 tgttcgtaaagaagctgagaattgcgattgtcttcaaggtacaatctattacttgtgcgatttagtacacttgtggaaatcttgattctgttatggcggt 34840023  T
120 tactaattttgcattttgtgattttgcggtttttagggtttcaggtgtgtcattcgttgggaggagg 186  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34840024 tactaattttgtattttgtgattttgcggtttttagggtttcaggtgtgtcattcgttgggaggagg 34840090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University