View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8248_low_44 (Length: 202)
Name: NF8248_low_44
Description: NF8248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8248_low_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 20 - 186
Target Start/End: Original strand, 34839924 - 34840090
Alignment:
| Q |
20 |
tgttcgtaaagaagctgagaattgcgattgtcttcaaggtacaatctatttcttgtgcgatttagtacacttgtggaaatcttgattctgttatggcggt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34839924 |
tgttcgtaaagaagctgagaattgcgattgtcttcaaggtacaatctattacttgtgcgatttagtacacttgtggaaatcttgattctgttatggcggt |
34840023 |
T |
 |
| Q |
120 |
tactaattttgcattttgtgattttgcggtttttagggtttcaggtgtgtcattcgttgggaggagg |
186 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34840024 |
tactaattttgtattttgtgattttgcggtttttagggtttcaggtgtgtcattcgttgggaggagg |
34840090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University