View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8249_high_11 (Length: 352)
Name: NF8249_high_11
Description: NF8249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8249_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 72 - 335
Target Start/End: Original strand, 43612235 - 43612498
Alignment:
| Q |
72 |
cttggagtttttcttgttgttggggttttcactctgcctcacttgttcttgtgactctgaggcaacagatactatttcctgaagccttgaacaaggaagc |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43612235 |
cttggagtttttcttgttgttggggttttcactctgcctcacttgttcttgtgactctgaggcaacagatactatttcctgaagccttgaacaaggaagc |
43612334 |
T |
 |
| Q |
172 |
ctgtgttgtctgagaagtggagaagagagtaactgctgccggtggcgggcgtagtatgggaaagagtgctgctgctgtgacagtggctgccaaattggaa |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43612335 |
ctgtgttgtctgagaagtggagaagagagtaactgctgccggtggcggccgtagtatgggaaagagtgctgttgctgtgacagtggctgccaaattggaa |
43612434 |
T |
 |
| Q |
272 |
aagctttgctggtggggaaaggatgataataatatgagtatgatgacatttggatatgagaaat |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43612435 |
aagctttgctggtggggaaaggatgataataatatgagtatgatgacatttggatatgagaaat |
43612498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 43612161 - 43612211
Alignment:
| Q |
1 |
acagggatgtgtttctgtctaggcacttgtattttagaaattcccacttct |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43612161 |
acagggatgtgtttctgtctaggcacttgtattttagaaattcccacttct |
43612211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University