View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8249_high_27 (Length: 219)
Name: NF8249_high_27
Description: NF8249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8249_high_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 26 - 203
Target Start/End: Complemental strand, 372146 - 371969
Alignment:
| Q |
26 |
aacattttaatccaaacttttataccatgtcatctccaacctgctacatcttcgtgggaaagtattcttcttctcatgcagttcccgccatgcagcacca |
125 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
372146 |
aacattttaacccaaacttttataccatgtcatctccaacctgctacatcttcgtgggaaagtattcttcttctcatgcagttcccgccatgcagcacca |
372047 |
T |
 |
| Q |
126 |
ccttccaaactgttgatgaagctcaagcgagaatacatattatggcttcttgaaacgaagcaaaataggtgagaatct |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
372046 |
ccttccaaactgttgatgaagctcaagcgagaatacatattatggcttcttgaaacgaagcaaaataggtgagaatct |
371969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University