View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8249_high_28 (Length: 218)

Name: NF8249_high_28
Description: NF8249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8249_high_28
NF8249_high_28
[»] chr4 (2 HSPs)
chr4 (17-114)||(53325494-53325591)
chr4 (166-209)||(53325643-53325686)


Alignment Details
Target: chr4 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 17 - 114
Target Start/End: Original strand, 53325494 - 53325591
Alignment:
17 ggatgcactaatacctcagtcctatcactttatgagggatatgtggctagacagatatgagaatgaaatgtacgatacaaccactttatttcaattca 114  Q
    |||||||||||||| | |||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||    
53325494 ggatgcactaatacgtgagtcctatcactttatgagggatatgtggctagacatatacgagaatgaaatgtacgatacaaccactttatttcaattca 53325591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 209
Target Start/End: Original strand, 53325643 - 53325686
Alignment:
166 gacatgccaaaatgcgtcaacaacgtaaagaatatttttcatct 209  Q
    |||||||||||||| |||||||||||||||||||||||||||||    
53325643 gacatgccaaaatgtgtcaacaacgtaaagaatatttttcatct 53325686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University