View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8249_high_30 (Length: 207)
Name: NF8249_high_30
Description: NF8249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8249_high_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 13 - 190
Target Start/End: Complemental strand, 31053709 - 31053532
Alignment:
| Q |
13 |
atgaataatgagtgaattgagttacctagagcgaaataagtgacgaaattggtttcaacggcagaaggaggaatgaggggaagattctgaacatcaggga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31053709 |
atgaataatgagtgaattgagttacctagagcgaaataagtgacgaaattggtttcaacggcagaaggaggaatgaggggaagattctgaacatcaggga |
31053610 |
T |
|
| Q |
113 |
gtagaagcttctctaaatcgtcttcttcttctaagatgcaaacatgcatatcatatacacaaacgagtcaaacaacat |
190 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31053609 |
gtagaagcttctctaaatcgtcctcttcttctaagatacaaacatgcatatcatatatacaaacgagtcaaacaacat |
31053532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 13 - 141
Target Start/End: Original strand, 53452128 - 53452256
Alignment:
| Q |
13 |
atgaataatgagtgaattgagttacctagagcgaaataagtgacgaaattggtttcaacggcagaaggaggaatgaggggaagattctgaacatcaggga |
112 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
53452128 |
atgaataaagagtgaattgagttacctagagcgaaataagtgacgaaattggtttcaatggcagaaggaggaatgaggggaaaattctcaacatcaggga |
53452227 |
T |
|
| Q |
113 |
gtagaagcttctctaaatcgtcttcttct |
141 |
Q |
| |
|
||||||||||||||||||| ||||||||| |
|
|
| T |
53452228 |
gtagaagcttctctaaatcatcttcttct |
53452256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University