View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8249_high_5 (Length: 464)
Name: NF8249_high_5
Description: NF8249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8249_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 391; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 391; E-Value: 0
Query Start/End: Original strand, 16 - 418
Target Start/End: Complemental strand, 54076214 - 54075812
Alignment:
| Q |
16 |
aacctgtgtgtccaatctttaggttcaacagcctcaaatcctaacccaggtgtcctatcttgcgagtttgggttcatagcttgtctccaatccacaacat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54076214 |
aacctgtgtgtccaatctttaggttcaacagcctcaaatcctaacccaggtgtcctatcttgcgagtttgggttcatagcttgtctccaatccacaacat |
54076115 |
T |
 |
| Q |
116 |
aagcagacactctccttctaaatttgctcttaaactcaacccacgcttggtacttataatgattcaccaaaccctcttcgggaccaagttgtttcgatct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54076114 |
aagcagacactctccttctaaatttgctcttaaactcaacccacgcttggtacttatagtgattcaccaaaccctcttcgggaccaagttgtttcgatct |
54076015 |
T |
 |
| Q |
216 |
aaacccttgtttctcattcacttgaaaatgatgtatcacattccacaaacttctatcaactgcttctaccaacacaattgatttgtgtctttgttccact |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54076014 |
aaacccttgtttctcattcacttgaaaatgatgtatcacattccacaaacttctatcaactgcttctaccaacacaattgatttgtgtctttgttccact |
54075915 |
T |
 |
| Q |
316 |
ttcctccgacacgtgtacccttgtgttaccccttctttcgggtgttgtctttgacctgatggcccaaattctaaacacatcattgacacctgtccaattc |
415 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54075914 |
ttcctccgacacgtgtacccctgtgttaccccttctttcgggtgttgtcgttgacctgatggcccaaattctaaacacatcattgacacctgtccaattc |
54075815 |
T |
 |
| Q |
416 |
tac |
418 |
Q |
| |
|
||| |
|
|
| T |
54075814 |
tac |
54075812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University