View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8249_low_28 (Length: 249)
Name: NF8249_low_28
Description: NF8249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8249_low_28 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 13 - 249
Target Start/End: Complemental strand, 48637364 - 48637128
Alignment:
| Q |
13 |
agaacagtcaaataaattcaaggaataagtctctgtggcaaagataagatcctaggactgatggtgtgaaatgagaaaatgaacagaacataaactcacc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48637364 |
agaacagtcaaataaattcaaggaataagtctctgtggcaaagataagatcctaggactgatggtgtgaaatgagaaaatgaacagaacataaactcacc |
48637265 |
T |
 |
| Q |
113 |
tcttctgtcagccattgcaaggtatcccaatcaacttcttccctaacaaaaacttcttcgtacttagctaacccgagaccacgtatccattcgacgacag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
48637264 |
tcttctgtcagccattgcaaggtatcccaatcaacttcttccctaacaaaaacttcttcgtacttagctaacccaagaccacgtatccattcgacgacag |
48637165 |
T |
 |
| Q |
213 |
gggagtttttcggcccaaattgagctcccacgtcatc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48637164 |
gggagtttttcggcccaaattgagctcccacatcatc |
48637128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University