View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8249_low_33 (Length: 218)
Name: NF8249_low_33
Description: NF8249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8249_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 17 - 114
Target Start/End: Original strand, 53325494 - 53325591
Alignment:
| Q |
17 |
ggatgcactaatacctcagtcctatcactttatgagggatatgtggctagacagatatgagaatgaaatgtacgatacaaccactttatttcaattca |
114 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53325494 |
ggatgcactaatacgtgagtcctatcactttatgagggatatgtggctagacatatacgagaatgaaatgtacgatacaaccactttatttcaattca |
53325591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 209
Target Start/End: Original strand, 53325643 - 53325686
Alignment:
| Q |
166 |
gacatgccaaaatgcgtcaacaacgtaaagaatatttttcatct |
209 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53325643 |
gacatgccaaaatgtgtcaacaacgtaaagaatatttttcatct |
53325686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University