View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8249_low_34 (Length: 210)
Name: NF8249_low_34
Description: NF8249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8249_low_34 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 16 - 193
Target Start/End: Complemental strand, 4413527 - 4413349
Alignment:
| Q |
16 |
gaagctaaaacacaaattaggtttatggtttctatataaacctaaaaaggatcannnnnnnngcaacagggtcnnnnnnnnccctttttt-aacgtaaaa |
114 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
4413527 |
gaagctaaaacacaaattaggtttacggtttctatataaacctaaaaaggatcattttatttgcaacagggtaaaaaaaaaccctttttttaacgtaaaa |
4413428 |
T |
|
| Q |
115 |
tctcattgattctaccaattttacgattctaggatcttacattcaaaaacccatttttgattttcaacaaaatcgttaa |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4413427 |
tctcattgattctaccaattttacgattctacgatcttacattcaaaaacccatttttgattttcaacaaaatctttaa |
4413349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University