View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8250_high_13 (Length: 262)
Name: NF8250_high_13
Description: NF8250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8250_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 77; Significance: 8e-36; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 6 - 106
Target Start/End: Complemental strand, 10392682 - 10392582
Alignment:
| Q |
6 |
tttcgtgttggcaaatgctttctgttggaattcatttatggtgtttgctttcgtgctaatttagtagttaggtacagaagccaattctatcacttctacg |
105 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
10392682 |
tttcgtggtggcaaatgctttctgttggaattcatttatggtgtttgctttcgtggtggtttagtaattagctacagaagccaattctatcacttctacg |
10392583 |
T |
|
| Q |
106 |
c |
106 |
Q |
| |
|
| |
|
|
| T |
10392582 |
c |
10392582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University