View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8250_high_16 (Length: 242)
Name: NF8250_high_16
Description: NF8250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8250_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 57 - 231
Target Start/End: Original strand, 54538054 - 54538228
Alignment:
| Q |
57 |
ttaagtttgttattcttgtccacaagttctaattcaacggacaaatatcaaaattgttaggttagatgttgtgacattaagttgaatttgagaccttata |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
54538054 |
ttaagtttgttattcttgtccacaagttctaactcaacggacaaatatcaaaactgttaggttagatgttgtgacattgagttgaatttgagaccctata |
54538153 |
T |
 |
| Q |
157 |
attgtatgtgtgagttttcaaatgatttttatcattcggtctatccaacaaaacaaaaaagagcgtgtcgttctt |
231 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
54538154 |
gttgtatgtgcgagttttcaaatgatttttatcattcggtctatctaacaaaacaaaaaagagtgtgtcgttctt |
54538228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 80 - 116
Target Start/End: Original strand, 23796477 - 23796513
Alignment:
| Q |
80 |
aagttctaattcaacggacaaatatcaaaattgttag |
116 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
23796477 |
aagttctaattcaactaacaaatatcaaaattgttag |
23796513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University