View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8250_high_20 (Length: 224)

Name: NF8250_high_20
Description: NF8250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8250_high_20
NF8250_high_20
[»] chr5 (1 HSPs)
chr5 (23-170)||(18057443-18057590)
[»] chr7 (2 HSPs)
chr7 (32-130)||(16687653-16687751)
chr7 (32-130)||(17661889-17661987)
[»] chr2 (1 HSPs)
chr2 (24-130)||(8453182-8453288)


Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 23 - 170
Target Start/End: Original strand, 18057443 - 18057590
Alignment:
23 atggaggaggtgaaagtattgtcttggaggtggacgtgtagtaggatgcacattccgacttgtctcattttcgagtggtgttggaatccccaattttgcc 122  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
18057443 atggaggaggtgaaagtattgtcttggaggtggacgtgtagtaggatgcacattccgacttgtctcattttcgagtggcgttggaatccccaattttgcc 18057542  T
123 ttgctaggagagcttcgcggacataaagggataccatccgggctgcta 170  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||    
18057543 ttgctaggagagcttcgcggacataaagggataccatctgggctgcta 18057590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 32 - 130
Target Start/End: Original strand, 16687653 - 16687751
Alignment:
32 gtgaaagtattgtcttggaggtggacgtgtagtaggatgcacattccgacttgtctcattttcgagtggtgttggaatccccaattttgccttgctagg 130  Q
    |||||||| |||||||||||||||  |  | ||||||||||  | | | |||||||  ||||||| ||||||||||||||| |||| ||||||||||||    
16687653 gtgaaagtgttgtcttggaggtgggtgctttgtaggatgcatttgctggcttgtctatttttcgaatggtgttggaatcccaaattgtgccttgctagg 16687751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 32 - 130
Target Start/End: Original strand, 17661889 - 17661987
Alignment:
32 gtgaaagtattgtcttggaggtggacgtgtagtaggatgcacattccgacttgtctcattttcgagtggtgttggaatccccaattttgccttgctagg 130  Q
    |||||||| |||||||||||||||  |  | ||||||||||  | | | |||||||  ||||||| ||||||||||||||| |||| ||||||||||||    
17661889 gtgaaagtgttgtcttggaggtgggtgctttgtaggatgcatttgctggcttgtctatttttcgaatggtgttggaatcccaaattgtgccttgctagg 17661987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 24 - 130
Target Start/End: Original strand, 8453182 - 8453288
Alignment:
24 tggaggaggtgaaagtattgtcttggaggtggacgtgtagtaggatgcacattccgacttgtctcattttcgagtggtgttggaatccccaattttgcct 123  Q
    ||||||||||||| || ||||||||||| |||| ||  ||||||||||| |||||| | || ||  |||  ||||| |||||||| |||||||| |||||    
8453182 tggaggaggtgaaggtgttgtcttggagatggatgttgagtaggatgcatattccggcatgccttttttatgagtgatgttggaacccccaattgtgcct 8453281  T
124 tgctagg 130  Q
    || ||||    
8453282 tggtagg 8453288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University