View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8250_low_23 (Length: 308)
Name: NF8250_low_23
Description: NF8250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8250_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 293
Target Start/End: Original strand, 50149155 - 50149450
Alignment:
| Q |
1 |
tcaacaacacagcagcttgttcatcttctcccaatttcttccaatgcgatcgattcataaacacttctttacctaaattcaataatctctgcttcatgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
50149155 |
tcaacaacacagcagcttgttcatcttctcccaatttcttccaatgcgatcgattcataaacacttctttccctaaattcaataatctctgcttcatgtt |
50149254 |
T |
|
| Q |
101 |
caaattatcaccaactttgcttccaccgc---cgccgccactgttactctttttcccctttcttgttccttcttcgttgtttcctttgcttatccctaat |
197 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50149255 |
caaattatcaccaactttgcttccgccgccgccgccgccactgttactctttttcccctttcttgttccttcttcgttgtttcctttgcttatccctaat |
50149354 |
T |
|
| Q |
198 |
atcgctctctttttcttcctgctcctgatcccgcaagcattgcacagtgactgtgtaatcaaacacaaattagatcagatcaagaacagtaataat |
293 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
50149355 |
attgctctctttttcttcctgctcctgatcccgcaagcattgcacagtgactgtgtaatcaaacacagattagatcagatcaagaacaataataat |
50149450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University