View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8250_low_24 (Length: 302)
Name: NF8250_low_24
Description: NF8250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8250_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 1 - 286
Target Start/End: Complemental strand, 43474963 - 43474678
Alignment:
| Q |
1 |
taaagtcagcaccggctaagaggacatgtgatgaattagttaccttctttagctcaacttttggaggtggttccttatagaaacttggcattggagcggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43474963 |
taaagtcagcaccggctaagaggacatgtgatgaattagttaccttctttagctcaacttttggaggtggttccttatagaaacttggcattggagcggc |
43474864 |
T |
|
| Q |
101 |
tttgaaagtcaagctcttcctcaattgcttgatctctttctcttggttttcctgagaacaaaaatatagagaataagctaaaaacctttgtatcaagaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43474863 |
tttgaaagtcaagctcttcctcaattgcttgatctctttctcttggttttcctgagaacaaaaatatagagaataagctaaaaacctttgtatcaagaat |
43474764 |
T |
|
| Q |
201 |
tcagatcgtgtccgatatatgttagggtccgacaccaacgtgcagttacattcaattattactagtgatgatgtgtcagtgttact |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43474763 |
tcagatcgtgtccgatatatgttagggtccgacaccaacgtgcagttacattcaattattactagtgatgatgtgtcagtgttact |
43474678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 38 - 154
Target Start/End: Original strand, 24261591 - 24261707
Alignment:
| Q |
38 |
agttaccttctttagctcaacttttggaggtggttccttatagaaacttggcattggagcggctttgaaagtcaagctcttcctcaattgcttgatctct |
137 |
Q |
| |
|
||||||||| || ||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |||| ||||| || |||| |||||||||| |
|
|
| T |
24261591 |
agttacctttttcagctcaacttttggaggaggttccttatagaaacttggcattggagctgctttgaatgtcattctctttcttaatttcttgatctct |
24261690 |
T |
|
| Q |
138 |
ttctcttggttttcctg |
154 |
Q |
| |
|
||||||| ||||||| |
|
|
| T |
24261691 |
gcctcttggctttcctg |
24261707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University