View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8250_low_32 (Length: 247)
Name: NF8250_low_32
Description: NF8250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8250_low_32 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 12 - 247
Target Start/End: Original strand, 2767326 - 2767561
Alignment:
| Q |
12 |
atggacatcagcttcaagagtgagatagtgaagattggaaggatctgatatgttgaagtagaagctctcattccaaacaggattaagatccttttcttta |
111 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2767326 |
atggacataagcttcaagagtgagatagtgaagattggaaggatctgatatgttgaagtagaagctctcattccaaacaggattaagatccttttcttta |
2767425 |
T |
|
| Q |
112 |
atggttgttcggaacttttggccgtcgaagtaaagttctacaaaggcattagaagaaccttctccatctttgggtagtagattgtgagcaccaaccacat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2767426 |
atggttgttcggaacttttggccgtcgaagtaaagttctacaaaggcattagaagaaccttctccatctttgggtagtagattgtgagcaccaaccacat |
2767525 |
T |
|
| Q |
212 |
ctacccctaactttaagttgatcataattaaatgtg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
2767526 |
ctacccctaactttaagttgatcataattaaatgtg |
2767561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University