View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8250_low_41 (Length: 224)
Name: NF8250_low_41
Description: NF8250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8250_low_41 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 23 - 170
Target Start/End: Original strand, 18057443 - 18057590
Alignment:
| Q |
23 |
atggaggaggtgaaagtattgtcttggaggtggacgtgtagtaggatgcacattccgacttgtctcattttcgagtggtgttggaatccccaattttgcc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18057443 |
atggaggaggtgaaagtattgtcttggaggtggacgtgtagtaggatgcacattccgacttgtctcattttcgagtggcgttggaatccccaattttgcc |
18057542 |
T |
|
| Q |
123 |
ttgctaggagagcttcgcggacataaagggataccatccgggctgcta |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
18057543 |
ttgctaggagagcttcgcggacataaagggataccatctgggctgcta |
18057590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 32 - 130
Target Start/End: Original strand, 16687653 - 16687751
Alignment:
| Q |
32 |
gtgaaagtattgtcttggaggtggacgtgtagtaggatgcacattccgacttgtctcattttcgagtggtgttggaatccccaattttgccttgctagg |
130 |
Q |
| |
|
|||||||| ||||||||||||||| | | |||||||||| | | | ||||||| ||||||| ||||||||||||||| |||| |||||||||||| |
|
|
| T |
16687653 |
gtgaaagtgttgtcttggaggtgggtgctttgtaggatgcatttgctggcttgtctatttttcgaatggtgttggaatcccaaattgtgccttgctagg |
16687751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 32 - 130
Target Start/End: Original strand, 17661889 - 17661987
Alignment:
| Q |
32 |
gtgaaagtattgtcttggaggtggacgtgtagtaggatgcacattccgacttgtctcattttcgagtggtgttggaatccccaattttgccttgctagg |
130 |
Q |
| |
|
|||||||| ||||||||||||||| | | |||||||||| | | | ||||||| ||||||| ||||||||||||||| |||| |||||||||||| |
|
|
| T |
17661889 |
gtgaaagtgttgtcttggaggtgggtgctttgtaggatgcatttgctggcttgtctatttttcgaatggtgttggaatcccaaattgtgccttgctagg |
17661987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 24 - 130
Target Start/End: Original strand, 8453182 - 8453288
Alignment:
| Q |
24 |
tggaggaggtgaaagtattgtcttggaggtggacgtgtagtaggatgcacattccgacttgtctcattttcgagtggtgttggaatccccaattttgcct |
123 |
Q |
| |
|
||||||||||||| || ||||||||||| |||| || ||||||||||| |||||| | || || ||| ||||| |||||||| |||||||| ||||| |
|
|
| T |
8453182 |
tggaggaggtgaaggtgttgtcttggagatggatgttgagtaggatgcatattccggcatgccttttttatgagtgatgttggaacccccaattgtgcct |
8453281 |
T |
|
| Q |
124 |
tgctagg |
130 |
Q |
| |
|
|| |||| |
|
|
| T |
8453282 |
tggtagg |
8453288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University