View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8250_low_42 (Length: 223)
Name: NF8250_low_42
Description: NF8250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8250_low_42 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 92 - 206
Target Start/End: Original strand, 40140116 - 40140230
Alignment:
| Q |
92 |
tgatgcggcgtttgcaatttcgaaacattgtcttgaaagcttaaacatgttcaactcattcactctgagcttatgataattttagctctcgttgttgcaa |
191 |
Q |
| |
|
||||||||| || |||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40140116 |
tgatgcggcattcgcaatttcgaaacattgtctcgaaagattaaacatgttcaactcattcactctgagcttatgataattttagctctcgttgttgcaa |
40140215 |
T |
|
| Q |
192 |
gaaaagggatgttag |
206 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
40140216 |
gaaaagggatgttag |
40140230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 39 - 81
Target Start/End: Complemental strand, 27645718 - 27645676
Alignment:
| Q |
39 |
tgggttattcgtgaatttggcttcgctacaaatagcaaagctc |
81 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
27645718 |
tgggttatttgtgaatttggcttcgctacatatagcaaagctc |
27645676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University