View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8251_high_40 (Length: 268)
Name: NF8251_high_40
Description: NF8251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8251_high_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 17 - 253
Target Start/End: Original strand, 40482875 - 40483111
Alignment:
| Q |
17 |
tgtttaacacttgcctttttgagagccaacaattgtttcatttcaatgtgaatatgaccaggagttaagtccccagtgctgggtgatgatacctcaagtt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40482875 |
tgtttaacacttgcctttttgagagccaacaattgtttcatttcaatgtgaatatgaccaggagttaagtctccagtgctgggtgatgatacctcaagtt |
40482974 |
T |
 |
| Q |
117 |
cactcgaattggtgaaagtctttgatttggaaggaaatgggattccaatatctgacttgtggaaagataggaaagcagttgttgcatttgctcgtcactt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40482975 |
cactcgaattggtgaaagtctttgatttggaaggaaatgggattccaatatctgacttgtggaaagataggaaagcagttgttgcatttgctcgtcactt |
40483074 |
T |
 |
| Q |
217 |
tgggtgattttctcttattagattcaaagatcaagct |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40483075 |
tgggtgattttctcttattagattcaaagatcaagct |
40483111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University