View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8251_high_48 (Length: 245)
Name: NF8251_high_48
Description: NF8251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8251_high_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 16 - 227
Target Start/End: Complemental strand, 42418435 - 42418224
Alignment:
| Q |
16 |
catcatgcatacatggtgatggtggaccatttaattgctttaattttggacccttctagtgagtagttaacttcaaatagcacttgtggtagagacgttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42418435 |
catcatgcatacatggtgatggtggaccatttaattgctttaattttggacccttctagtgagtagttaacttcaaatagcacttgtggtagagacgttt |
42418336 |
T |
 |
| Q |
116 |
gacattaaaagttccnnnnnnngtcagttattattgagtaccaaccccttcaattcaattaagagaaagttgaagaccccataactttgtggtttctctt |
215 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
42418335 |
gacattaaaagttcctttttttgtcagttattattgagtaccaaccccttcaattcaattaagagagagttgaagaccccataactttgtggtttctcct |
42418236 |
T |
 |
| Q |
216 |
cttctcaccttt |
227 |
Q |
| |
|
|||||||||||| |
|
|
| T |
42418235 |
cttctcaccttt |
42418224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University