View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8251_high_56 (Length: 219)
Name: NF8251_high_56
Description: NF8251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8251_high_56 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 11 - 203
Target Start/End: Complemental strand, 52762168 - 52761977
Alignment:
| Q |
11 |
cagaacctgtgcaacttgttcaattgatcattccaattgaatcagctcagcgatccatctcttaccttggcgatctcggcctttttcaattcaaagatgt |
110 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52762168 |
cagaacctatgcaacttgttcaattgatcattccaattgaatcagctcagcgatccatctcttaccttggcgatctcggcctttttcaattcaaagatgt |
52762069 |
T |
 |
| Q |
111 |
atgaatcctttaattaccaatctttgtcctttctcactttgcattcttgatgacgcttcggactacattttccataatgttgagatgttcttc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52762068 |
atgaatcctttaattaccaatctttgtcc-ttctcactttgtattctttatgacgcttcggactacattttccataatgttgagatgttcttc |
52761977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University