View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8251_low_36 (Length: 348)
Name: NF8251_low_36
Description: NF8251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8251_low_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 1 - 335
Target Start/End: Complemental strand, 45975424 - 45975073
Alignment:
| Q |
1 |
aacataaagttcaatagttttaaaatgcagcgaaataatgcagtcaatatcacaaatcacaatcgccatgtcgttgcagattttgaagtctatgcatagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45975424 |
aacataaagttcaatagttttaaaatgcagcgaaataatgcagtcaatatcacaaatcacaatcgccatgtcgttgcagattttgaagtctatgcatagt |
45975325 |
T |
|
| Q |
101 |
ttaaccgcg-----------------atttaaaaccattggtgcgatggtgagacgtagttaaaaaatgaaatggttgtgcaatcttgtttagttttgta |
183 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45975324 |
ttaaccgcgtaagagccacaaccgcgatttaaaaccattggtgcgatggtgagatgtagttaaaaaatgaaatggttgtgcaatcttgtttagttttgta |
45975225 |
T |
|
| Q |
184 |
cccatagacgataagaaacagactcagcatcccaattttcagtgccaggagtgagaacaggctccgacacaagacttgccaaagaagcaagcctcttcgc |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45975224 |
cccatagacgataagaaacagactcagcatcccaattttcagtgccaggagtgagaacaggctccgacacaagacttgccaaagaagcaagcctcttcgc |
45975125 |
T |
|
| Q |
284 |
taacgtaagctgcaggatatagctttcttcacacttcttcaccaacccgtct |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45975124 |
taacgtaagctgcaggatatagctttcttcacacttcttcaccaacccgtct |
45975073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University