View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8251_low_47 (Length: 304)
Name: NF8251_low_47
Description: NF8251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8251_low_47 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 78 - 289
Target Start/End: Original strand, 32882469 - 32882682
Alignment:
| Q |
78 |
gaagtcattgagaaagtgttgaaagaaaatctcggaccggatttctctgagaagtaagttgcactcactaactgaattttgattttatgaattctttatc |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32882469 |
gaagtcattgagaaagtgttgaaagaaaatctcggaccggatttctctgagaagtaagttgcactcactaactgaattttgattttatgaattctttatc |
32882568 |
T |
|
| Q |
178 |
gttcattgtttatcttataagagc--ttttgtgtataagctttgactctgtttggtatggtaaaggcacatatttgagtttatagtttatgacttatagc |
275 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32882569 |
gttcattgtttatcttataagagcttttttgtgtataagctttgactctgtttggtatggtaaaggcacatatttgagtttatagtttatgacttatagc |
32882668 |
T |
|
| Q |
276 |
ttttaagttcttct |
289 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32882669 |
ttttaagttcttct |
32882682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University