View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8251_low_67 (Length: 239)
Name: NF8251_low_67
Description: NF8251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8251_low_67 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 27598289 - 27598512
Alignment:
| Q |
1 |
aaatatataacaaaaacatgaatgaaaaggaccctaatctttttgctacttgtctcttatgcttatgttagtgtcttttatttcgctattttcaatttac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27598289 |
aaatatataacaaaaacatgaatgaaaaggaccctaatctttttgctacttgtctcttatgcttatgttagtgtcttttatttctctattttcaatttac |
27598388 |
T |
|
| Q |
101 |
actttatatggtatttatttgtgcttgggcttagcttgcagttgcaccagtcattgctagagaggagaatctt-gttatatactaatacaaatgaaaatt |
199 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27598389 |
gctttatatggtatttatctgtgcttgggcttagcttgcagttgcaccagtcattgctagagaggagaatcttggttatatactaatacaaatgaaaatt |
27598488 |
T |
|
| Q |
200 |
gacaattccatgttaccacaaaag |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
27598489 |
gacaattccatgttaccacaaaag |
27598512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University