View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8251_low_69 (Length: 238)
Name: NF8251_low_69
Description: NF8251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8251_low_69 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 32484311 - 32484087
Alignment:
| Q |
1 |
tttcaagatcttgggcgagggaagaattgcgtaccactagccgtcatgaaggcattaatcggagccgaatacaacgaagaaggatcaacaagtgcgcccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32484311 |
tttcaagatcttgggcgagggaagaattgcgtaccactagccgtcatgaaggcattaatcggagccgaatacaacgaagaaggatcaacaagtgcgcccg |
32484212 |
T |
 |
| Q |
101 |
aagaggcaacaacagtggtatcagagtcggcaattaggttcaacggttgagcaacgccaacaccgcctccaccggaagtctccccaatcatgtaattact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32484211 |
aagaggcaacaacagtggtatcagagtcggcaattaggttcaacggttgagcaacgccaacaccgcctccaccggaagtctccccaatcatgtaattact |
32484112 |
T |
 |
| Q |
201 |
attattataattactattgttgttg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
32484111 |
attattataattactattgttgttg |
32484087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 2 - 91
Target Start/End: Complemental strand, 8103092 - 8103003
Alignment:
| Q |
2 |
ttcaagatcttgggcgagggaagaattgcgtaccactagccgtcatgaaggcattaatcggagccgaatacaacgaagaaggatcaacaa |
91 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||| | |||||||| ||||| ||||| | |||||| |||||||||||||||| |
|
|
| T |
8103092 |
ttcaagatcttgggtgggggaagaattgcgtaccactagaaggcatgaaggtattaagtggagctggatacaaagaagaaggatcaacaa |
8103003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University