View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8251_low_74 (Length: 208)
Name: NF8251_low_74
Description: NF8251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8251_low_74 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 16 - 104
Target Start/End: Original strand, 7279257 - 7279345
Alignment:
| Q |
16 |
atgaacaggaattgaaaccaccttcgatggtgattgtgctttcttgttgtaacgaggataattccattgggtgccgtacgaggaagaag |
104 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7279257 |
atgaaccggaattgaaaccaccttcgatggtgattgtgctttcttgttgtaacgaggataattccattgggtgccgtacaaggaagaag |
7279345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 16 - 104
Target Start/End: Complemental strand, 7374582 - 7374494
Alignment:
| Q |
16 |
atgaacaggaattgaaaccaccttcgatggtgattgtgctttcttgttgtaacgaggataattccattgggtgccgtacgaggaagaag |
104 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7374582 |
atgaaccggaattgaaaccaccttcgatggtgattgtgctttcttgttgtaacgaggataattccattgggtgccgtacaaggaagaag |
7374494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University