View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8252_high_11 (Length: 215)

Name: NF8252_high_11
Description: NF8252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8252_high_11
NF8252_high_11
[»] chr6 (1 HSPs)
chr6 (15-199)||(33592408-33592592)


Alignment Details
Target: chr6 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 15 - 199
Target Start/End: Complemental strand, 33592592 - 33592408
Alignment:
15 atacttcacaaatcatgaacattaaaaaataattttgcttcgtacatgtttttcacatacatagatgaaaaatgtgtttttgacaccaaaaaatccgaca 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33592592 atacttcacaaatcatgaacattaaaaaataattttgcttcgtacatgtttttcacatacatagatgaaaaatgtgtttttgacaccaaaaaatccgaca 33592493  T
115 ttaccccggaatatttaaacactttgcaacttttatactataatttccttctatccgggtccgacatccaggcttattcgtatct 199  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33592492 ttaccccagaatatttaaacactttgcaacttttatactataatttccttctatccgggtccgacatccaggcttattcgtatct 33592408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University