View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8252_low_15 (Length: 215)
Name: NF8252_low_15
Description: NF8252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8252_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 15 - 199
Target Start/End: Complemental strand, 33592592 - 33592408
Alignment:
| Q |
15 |
atacttcacaaatcatgaacattaaaaaataattttgcttcgtacatgtttttcacatacatagatgaaaaatgtgtttttgacaccaaaaaatccgaca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33592592 |
atacttcacaaatcatgaacattaaaaaataattttgcttcgtacatgtttttcacatacatagatgaaaaatgtgtttttgacaccaaaaaatccgaca |
33592493 |
T |
 |
| Q |
115 |
ttaccccggaatatttaaacactttgcaacttttatactataatttccttctatccgggtccgacatccaggcttattcgtatct |
199 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33592492 |
ttaccccagaatatttaaacactttgcaacttttatactataatttccttctatccgggtccgacatccaggcttattcgtatct |
33592408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University