View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8252_low_4 (Length: 443)
Name: NF8252_low_4
Description: NF8252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8252_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 8e-99; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 8e-99
Query Start/End: Original strand, 235 - 429
Target Start/End: Complemental strand, 42225710 - 42225516
Alignment:
| Q |
235 |
ctatcattttgtttttgatttagttcttaaactacatgaatataataagtagtttttaacgtatatgaaatttatcaacttagtctttaaaatacatgaa |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42225710 |
ctatcattttgtttttgatttagttcttaaactacatgaatataataagtagtttttaacgtatatgaaatttatcaacttagtctttaaaatacatgaa |
42225611 |
T |
 |
| Q |
335 |
aatctttctattaaggaaatggcatcttgagcaggaactaaatcgtctgcgtttatgtactttatgaattatacctttcatatttagatagttta |
429 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42225610 |
aatctttctattaaggaaatggcatcttgagcaggaactaaatcgtctgcttttatatactttatggattatacctttcatatttagatagttta |
42225516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 149; E-Value: 2e-78
Query Start/End: Original strand, 16 - 164
Target Start/End: Complemental strand, 42225942 - 42225794
Alignment:
| Q |
16 |
cagacacaggtaacatcaaaagaggtttggctaattcatggaaacacccttatggtatcacctttcccggcaaacctgccggtcgtttctccgacggaag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42225942 |
cagacacaggtaacatcaaaagaggtttggctaattcatggaaacacccttatggtatcacctttcccggcaaacctgccggtcgtttctccgacggaag |
42225843 |
T |
 |
| Q |
116 |
agtcctcaccgactacattggtacgtgtgtttttgttcaacaaattcct |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42225842 |
agtcctcaccgactacattggtacgtgtgtttttgttcaacaaattcct |
42225794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 193 - 234
Target Start/End: Complemental strand, 42225765 - 42225724
Alignment:
| Q |
193 |
gtacgggtaatcgtgagatgttttttgcttttgactcattct |
234 |
Q |
| |
|
||||| || ||||| ||||||||||||||||||||||||||| |
|
|
| T |
42225765 |
gtacgtgttatcgttagatgttttttgcttttgactcattct |
42225724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University