View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8253_high_27 (Length: 251)
Name: NF8253_high_27
Description: NF8253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8253_high_27 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 126 - 236
Target Start/End: Original strand, 585621 - 585731
Alignment:
| Q |
126 |
ctgaagccgcgcgattgaaactatagttttaaaacaactttgatcatactctataacaatgacttttctgatagaaggcgttcttgtttgacactcacgt |
225 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
585621 |
ctgaagctgcgcgattgaaactatagttttaaaacaactttgatcatactctataacaatgactcttctgatagaaggcgttcttgtttgacactcacgt |
585720 |
T |
|
| Q |
226 |
aacgctgacac |
236 |
Q |
| |
|
||||||||||| |
|
|
| T |
585721 |
aacgctgacac |
585731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University