View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8253_low_10 (Length: 412)
Name: NF8253_low_10
Description: NF8253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8253_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 9e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 9e-80
Query Start/End: Original strand, 235 - 393
Target Start/End: Complemental strand, 6877979 - 6877821
Alignment:
| Q |
235 |
ctccgcggcctctaattctgccatgtattccatggcagaatagagactagaggttgcggagatgagtttctccgctttctcaatgatcttgatagagctc |
334 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6877979 |
ctccgcggcctctaattctgccatatattccatggcagaatagagactagaggtcgcggagatgagtttctccgctttctcaatgatcttgatagagctc |
6877880 |
T |
 |
| Q |
335 |
cgagagttgtatggcagctttcggagatcaattacaccttgtttaagatcggcatagac |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6877879 |
cgagagttgtatggcagctttcggagatcaattacaccttgtttaagatcggcatagac |
6877821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 20 - 170
Target Start/End: Complemental strand, 6878194 - 6878044
Alignment:
| Q |
20 |
ccgaaaacggagcatattcttgcatacacaatgcacacaagccttgccatgatcccaaccgttttgtcaaatgtttgtttccataacgatgtttccttga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | |
|
|
| T |
6878194 |
ccgaaaacggagcatattcttgcatacacaatgcacacaagccttgccatgatcccaaccgttttgtcaaatgtttgtttccataatgatgtttccttaa |
6878095 |
T |
 |
| Q |
120 |
aattttgcacttgctttctttgaaacactaatttctcgttgaaatattcca |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6878094 |
aattttgcacttgctttctttgaaacactaatttctcattgaaatattcca |
6878044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University