View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8253_low_16 (Length: 341)
Name: NF8253_low_16
Description: NF8253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8253_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 15 - 326
Target Start/End: Original strand, 31437599 - 31437910
Alignment:
| Q |
15 |
atatatattgagaacggctttgtttgtaaaaagacaatagtaagagtcacatgctggctgctgattttcctacttgtctaagagcatcttaataagttta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31437599 |
atatatattgagaacggctttgtttgtaaaaagacaatagtaagagtcacatgctggctgctgattttcctacttgtctaagagcatcttaataagttta |
31437698 |
T |
 |
| Q |
115 |
tataagtcttttcaagttgttttttgtactgagattgttgatcaagcttagtgaacctttctaagaaaaggtatctctccaaaagggagagtctataggg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31437699 |
tataagtcttttcaagttgttttttgtactgagattgttgatcaagcttagtgaacctttctaagaaaaggtatctctccaaaagggagagtctataggg |
31437798 |
T |
 |
| Q |
215 |
aaaatggggagcaatagcatgtttcgttacgcagatggatttgataaattgttgatgttcttcgggactcttggaagtcttggtgatggtctgcagaatc |
314 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31437799 |
aaaatggggagcaatagcatgtttcgttatgcagatggattcgataaattgttgatgttcttcgggactcttggaagtcttggtgatggtctgcagaatc |
31437898 |
T |
 |
| Q |
315 |
ctctcatgatgt |
326 |
Q |
| |
|
|||||||||||| |
|
|
| T |
31437899 |
ctctcatgatgt |
31437910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University