View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8253_low_25 (Length: 274)
Name: NF8253_low_25
Description: NF8253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8253_low_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 43611587 - 43611334
Alignment:
| Q |
1 |
tgtggccaatggaaacaattcaaactatgccaatgacgacatccttcaaaccgggaatggaaatgggaaggtctatcaggatatacagcttcaaccgcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43611587 |
tgtggccaatggaaacaattcaaactatgccaatgacgacatccttcaaaccgggaatggaaatgggaaggtctatcaggatatacagcttcaaccgcaa |
43611488 |
T |
|
| Q |
101 |
aagtctatgctctctgagtatgctcttagcctcgggagtcttttgcgttctcttgacataactcccaacaacgattctgatacagggtcaaggtttctgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43611487 |
aagtctatgctctctgagtatgctctcagcctcgggagtcttttgcgttctcttgacataactcccaacaacgattctgatacagggtccaggtttctgc |
43611388 |
T |
|
| Q |
201 |
tcctttccacttaacatgcttctttgaattcaattgttcctctcaactttatag |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43611387 |
tcctttccacttaacatgcttctttgaattcaattgttcctctcaactttatag |
43611334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University