View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8254_high_5 (Length: 247)
Name: NF8254_high_5
Description: NF8254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8254_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 195
Target Start/End: Complemental strand, 3605674 - 3605498
Alignment:
| Q |
18 |
attggcggattttcttcttttggtgtctattaaaaattcaaagaatgacttttgtgtcttcaacgttagatccatccatatgctagatattccagacacc |
117 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||||| ||||| ||||||||||| ||||||||||||||||| |||||||||| |||| |
|
|
| T |
3605674 |
attggcggattttcttcatttgatgtctattaaaaattcaaagaatgatttttgcgtcttcaacgtcagatccatccatatgctggatattccag-cacc |
3605576 |
T |
 |
| Q |
118 |
tgtattttgtcacaattgtatgcattatgcttattttgctgtaaacctgaatgctatgagtttattcacaatttcatc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3605575 |
tgtattttgtcacaattgtatgcattatgcttattttgctgtaaacttgaatgctatgagtttattcacaatttcatc |
3605498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University