View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8254_low_12 (Length: 244)
Name: NF8254_low_12
Description: NF8254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8254_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 226
Target Start/End: Original strand, 6426205 - 6426415
Alignment:
| Q |
16 |
gtgttctttaattatggctcgattagtagttaggcctgaggacttattcaagctcttaaatggattattcctttggagtatactaatgtgttctttgaga |
115 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6426205 |
gtgttctttaattatggctcgattagtggttaggcctgaggacttattcaagctcttaaatggattattcctttggagtatactaatgtgttctttgaga |
6426304 |
T |
 |
| Q |
116 |
ttgattataaactagtgatataaatgatgtgctcaaagataaatcttatcatacgaaatatggattacataaattaaggaaggaagccatgggaggctca |
215 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
6426305 |
tcgattataaactagtgatataaatgatgtgctcaaagataaatcttatcatacgaaatatggattacataaattaaggaaggaaaccatgtgaggctca |
6426404 |
T |
 |
| Q |
216 |
gaggcttaaag |
226 |
Q |
| |
|
||||||||||| |
|
|
| T |
6426405 |
gaggcttaaag |
6426415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University