View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8254_low_9 (Length: 316)
Name: NF8254_low_9
Description: NF8254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8254_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 271; Significance: 1e-151; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 15 - 313
Target Start/End: Complemental strand, 29776790 - 29776492
Alignment:
| Q |
15 |
ttctcacttgcttgacaatgtccaaaacaattcaatattttgatctcaacaccggagccaaaatcccttccgttggcttgggaacttggcaagccgagga |
114 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29776790 |
ttctcacttgcttgacaatgtccaaggcaattcaattctttgatctcaacaccggagccaagatcccttccgttggcttgggaacttggcaagccgagga |
29776691 |
T |
|
| Q |
115 |
cgatcctggcctcgttgctgaagccgtcgcttctgccatcaaggtaaattttcattatcattcatccttccacttgagttttggaaatctctttgtatat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29776690 |
cgatcctggcctcgttgctgaagccgtcgctactgccatcaaggtaaattttcattatcattcatccttccacttgagttttggaaatctctttgtatat |
29776591 |
T |
|
| Q |
215 |
aatataatgaataatgatattttcttttatacatacaggccggttaccgtcacattgattgtgctcaattatatggcaatcagaaggaggtagctattt |
313 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29776590 |
aatataatgaataatgatattttctttgatacatacaggccggttaccgtcacattgattgtgctcaattatatggcaatcagaaggaggtagctattt |
29776492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 248 - 306
Target Start/End: Complemental strand, 29786906 - 29786848
Alignment:
| Q |
248 |
tacaggccggttaccgtcacattgattgtgctcaattatatggcaatcagaaggaggta |
306 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
29786906 |
tacaggctggttaccgtcacattgattgtgctcaagtctatggcaatgagaaggaggta |
29786848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 58 - 105
Target Start/End: Complemental strand, 29787095 - 29787048
Alignment:
| Q |
58 |
tctcaacaccggagccaaaatcccttccgttggcttgggaacttggca |
105 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||| |||||||| |
|
|
| T |
29787095 |
tctcaacaccggagccaagatcccttccgtcggcttgggtacttggca |
29787048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University