View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8255_low_9 (Length: 206)
Name: NF8255_low_9
Description: NF8255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8255_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 8 - 177
Target Start/End: Complemental strand, 36832589 - 36832420
Alignment:
| Q |
8 |
cgacacttctgataaaagttatgttacgtgtccagcacatgtggttatatttgattaattcatagtatctacgacgttgcttattcatcggtaaacatca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36832589 |
cgacacttctgataaaagttatgttacgtgtccagcacatgtggttatatttgattaattcatagtatctacgacgttgcttattcatcggtaaacatca |
36832490 |
T |
 |
| Q |
108 |
agtatatataaattgtagcaaatatatgcaggcatgcactgaagcacatgaaagaagggagcagtattat |
177 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36832489 |
agtatatatcaattgtagcaaatatatgcaggcatgcactgaagcacatgaaagaagggagcagtattat |
36832420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 132 - 165
Target Start/End: Original strand, 54958556 - 54958589
Alignment:
| Q |
132 |
tatgcaggcatgcactgaagcacatgaaagaagg |
165 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
54958556 |
tatgcaggcatgctctgaagcacatgaaagaagg |
54958589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University