View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8256_high_5 (Length: 240)
Name: NF8256_high_5
Description: NF8256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8256_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 1084705 - 1084587
Alignment:
| Q |
1 |
gacggaggtagtaaatattatgatttactattagatacatcacttattcaataaatctgaagnnnnnnn-ggaatatttgtttatatttgagaccaaagg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
1084705 |
gacggaggtagtaaatattatgatttac------atacatcacttattcaataaatctgaagaaaaaagaggaatatttgtttatatttgagatcaaagg |
1084612 |
T |
 |
| Q |
100 |
-atagtctaagcttgattcaatttc |
123 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
1084611 |
aatagtctaagcttgattcaatttc |
1084587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 185 - 224
Target Start/End: Complemental strand, 1084525 - 1084486
Alignment:
| Q |
185 |
tctaacaaaatgctattttgtatgatatcgaagtatatag |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1084525 |
tctaacaaaatgctattttgtatgatatcgaagtatatag |
1084486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University