View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8257_low_14 (Length: 203)
Name: NF8257_low_14
Description: NF8257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8257_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 13 - 186
Target Start/End: Complemental strand, 40750090 - 40749917
Alignment:
| Q |
13 |
atgaatgatgattaatctgttgattttcttggttcaaccacagtgacaagtttggtctttgctcatgatgaaatcctgcatgtggactaaactgttgaag |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40750090 |
atgaatgatgattaatctgttgattttcttggttcaaccacagtgacaaatttggtctttgctcatgatgaaatcctgcatgtggactaaattgttgaat |
40749991 |
T |
 |
| Q |
113 |
attttgaagtccttgagatgatatcaatccatgggccaaactagtttgtgtgttcatcatattggactcttcat |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40749990 |
attttgaagtccttgagatgatatcaatccatgggccaaactagtttgtgtgttcatcatattggactcttcat |
40749917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University