View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8257_low_14 (Length: 203)

Name: NF8257_low_14
Description: NF8257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8257_low_14
NF8257_low_14
[»] chr7 (1 HSPs)
chr7 (13-186)||(40749917-40750090)


Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 13 - 186
Target Start/End: Complemental strand, 40750090 - 40749917
Alignment:
13 atgaatgatgattaatctgttgattttcttggttcaaccacagtgacaagtttggtctttgctcatgatgaaatcctgcatgtggactaaactgttgaag 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||     
40750090 atgaatgatgattaatctgttgattttcttggttcaaccacagtgacaaatttggtctttgctcatgatgaaatcctgcatgtggactaaattgttgaat 40749991  T
113 attttgaagtccttgagatgatatcaatccatgggccaaactagtttgtgtgttcatcatattggactcttcat 186  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40749990 attttgaagtccttgagatgatatcaatccatgggccaaactagtttgtgtgttcatcatattggactcttcat 40749917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University