View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8257_low_9 (Length: 333)
Name: NF8257_low_9
Description: NF8257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8257_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 1 - 312
Target Start/End: Original strand, 9702834 - 9703145
Alignment:
| Q |
1 |
tggtactggaaaatgctttctagtgacaggtcctccggtgagtgattcctccatcaattttaacttttcctctctttgaaatctctatcacttcaatcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9702834 |
tggtactggaaaatgctttctagtgacaggtcctccggtgagtgattcctccatcaattttaacttttcctctctttgaaatctctatcacttcaatcat |
9702933 |
T |
 |
| Q |
101 |
taatcatgattcatataatttattaaaatgattttagggtgtgggaaaaagcactcttattatgagagtcttcgaatccctcaaagcctcaaaccccaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9702934 |
taatcatgattcatataatttattaaaatgattttagggtgtgggaaaaagcactcttattatgagagtcttcgaatccctcaaagcctcaaaccccaca |
9703033 |
T |
 |
| Q |
201 |
cttaaggttcagggtttctacacacgtaagcatctcttcctttttccttcacaccatcacttcacaaattcccaaaacttttcattggtttgttttgttt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9703034 |
cttaaggttcagggtttctacacacgtaagcgtctcttcctctttccttcacaccatcccttcacaaattcccaaaacttttcattggtttgttttgttt |
9703133 |
T |
 |
| Q |
301 |
gtaggtgaagtt |
312 |
Q |
| |
|
|||||||||||| |
|
|
| T |
9703134 |
gtaggtgaagtt |
9703145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University